O seu navegador (Generic Browser 0) está desatualizado. Melhore sua experiência em nosso site!
Atualize Agora

Questões de Concursos

Q799371 Biologia
A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses. CACTTGTAAAACCAGTATAGACCCTAG(1) CACTTGTAAAACCAGGATAGACGCTAG(2) CACTTGTAAAACCAGTATAGACGCTAG(3) CATTTTTAACACCAGGATAGACGCTAT(4) Assinale a alternativa correta.
Você errou!   Resposta: Parabéns! Você acertou!