Atualizando histórico

Estamos atualizando seu histórico de questões resolvidas, por favor aguarde alguns instantes.

Menu
Cadastre-se

Núcleo interfásico e código genético


QUESTÕES PARA PRATICAR

(9 questões)
Ver no modo completo: Todas as questões
01
Q799371
Aplicada em: 2016
Banca: COMVEST - UNICAMP
Órgão: UNICAMP
Prova: Vestibular
A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses.
CACTTGTAAAACCAGTATAGACCCTAG(1)
CACTTGTAAAACCAGGATAGACGCTAG(2)
CACTTGTAAAACCAGTATAGACGCTAG(3)
CATTTTTAACACCAGGATAGACGCTAT(4)
Assinale a alternativa correta. 

Você configurou para não ver comentários antes de resolver uma questão.

Anterior Anterior